WebJan 1, 2010 · The Expand Long Template Enzyme mix is used to amplify the pre-amiRNA fragment as this system contains a mixture of two Taq DNA polymerases to allow for (1) proofreading of amplified PCR products and (2) A-tailing of the amplified product. A-tailing enables ligation between the pre-amiRNA PCR product and the pGEM®-T Easy vector. WebSynonyms: long template pcr; longe range pcr; nucleotide mixes and sets; pcr enzymes Storage: −20°C UNSPSC Code: 12352200 Components: Expand Long Range Enzyme Mix; Expand Long Range Buffer with 12.5 mM MgCl 2 5x concentrated; Expand Long Range Buffer without MgCl 2 5x concentrated; MgCl 2 Stock Solution 25 mM; DMSO …
Vectors and Methods for Hairpin RNA and Artificial microRNA
Webof each primer, 350 M of each dNTP, 0.75 l of Expand long template enzyme mix, and 1 reaction buffer (Roche Applied Science). XhoI-containing primers were ATCACCTCGAGCA-CCATGGGCCTGCTCCTGCTGGTTCTCATTC as forward primer and ATCACCTCGAGGCTTCAGTACAGGTGGATA as reverse primer. Each PCR product … WebPrimeSTAR GXL is a hot-start, high-fidelity enzyme that is optimized to amplify GC-rich templates, samples with excess templates, and long PCR products up to 30 kb. PrimeSTAR GXL Premix enables you to simplify your amplification workflow, saving you time and reducing potential errors. Simply add primers and template, and you are ready … scioto landing fischer homes
PCR DIG Probe Synthesis Kit - University of Kentucky
WebRoche expand long template enzyme mix Expand Long Template Enzyme Mix, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more WebJan 1, 2013 · Expand Long Template Enzyme mix is use for efficient amplification of GC-rich DNA template. Instead of standard PCR elongation temperature at 72 °C, the optimal primer extension temperature is reduced to 68 °C to avoid enzyme loss during prolonged extension times. 8. WebExpand Long Template Enzyme Mix, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, … prayer for our country during this time